ORIGINAL RESEARCHThe Hippo Kinase LATS2 Controls Helicobacter pylori-Induced
Epithelial-Mesenchymal Transition and Intestinal Metaplasia in
Gastric Mucosa
Silvia Elena Molina-Castro,1,2 Camille Tiffon,1 Julie Giraud,1 Hélène Boeuf,3 Elodie Sifre,1
Alban Giese,1 Geneviève Belleannée,4 Philippe Lehours,1,4 Emilie Bessède,1,4
Francis Mégraud,1,4 Pierre Dubus,1,4 Cathy Staedel,5 and Christine Varon1
1INSERM, UMR1053, Bordeaux Research in Translational Oncology, BaRITOn, 3INSERM, UMR1026, Bioingénierie tissulaire
(BioTis), 5INSERM, UMR1212, University of Bordeaux, Bordeaux, France; 2University of Costa Rica, San José, Costa Rica;
4Centre Hospitalier Universitaire (CHU) de Bordeaux, Bordeaux, FranceSUMMARY
The tissue homeostasis-regulating Hippo signaling pathway is
activated during Helicobacter pylori infection. The Hippo core
kinase large tumor suppressor 2 was found to protect gastric
cells from infection-induced epithelial-to-mesenchymal transi-
tion andmetaplasia, a preneoplastic transdifferentiation at high
risk for gastric cancer development.
BACKGROUND & AIMS: Gastric carcinoma is related mostly
to CagAþ-Helicobacter pylori infection, which disrupts the
gastric mucosa turnover and elicits an epithelial-
mesenchymal transition (EMT) and preneoplastic
transdifferentiation. The tumor suppressor Hippo pathway
controls stem cell homeostasis; its core, constituted by the
large tumor suppressor 2 (LATS2) kinase and its substrate
Yes-associated protein 1 (YAP1), was investigated in this
context.
METHODS: Hippo, EMT, and intestinal metaplasia marker
expression were investigated by transcriptomic and immuno-
staining analyses in human gastric AGS and MKN74 and non-
gastric immortalized RPE1 and HMLE epithelial cell lineschallenged by H pylori, and on gastric tissues of infected
patients and mice. LATS2 and YAP1 were silenced using small
interfering RNAs. A transcriptional enhanced associated
domain (TEAD) reporter assay was used. Cell proliferation and
invasion were evaluated.
RESULTS: LATS2 and YAP1 appear co-overexpressed in the
infected mucosa, especially in gastritis and intestinal meta-
plasia. H pylori via CagA stimulates LATS2 and YAP1 in a co-
ordinated biphasic pattern, characterized by an early transient
YAP1 nuclear accumulation and stimulated YAP1/TEAD tran-
scription, followed by nuclear LATS2 up-regulation leading to
YAP1 phosphorylation and targeting for degradation. LATS2
and YAP1 reciprocally positively regulate each other’s expres-
sion. Loss-of-function experiments showed that LATS2 restricts
H pylori–induced EMT marker expression, invasion, and intes-
tinal metaplasia, supporting a role of LATS2 in maintaining the
epithelial phenotype of gastric cells and constraining H pylo-
ri–induced preneoplastic changes.
CONCLUSIONS: H pylori infection engages a number of
signaling cascades that alienate mucosa homeostasis, including
the Hippo LATS2/YAP1/TEAD pathway. In the host–pathogen
conflict, which generates an inflammatory environment and
perturbations of the epithelial turnover and differentiation,
258 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2Hippo signaling appears as a protective pathway, limiting
the loss of gastric epithelial cell identity that precedes
gastric carcinoma development. (Cell Mol Gastroenterol Hepatol
2020;9:257–276; https://doi.org/10.1016/j.jcmgh.2019.10.007)
Keywords: YAP1; Epithelial-to-Mesenchymal Transition;
Adenocarcinoma; CagA.
See editorial on page 335.he gram-negative microaerophilic bacterium Heli-Abbreviations used in this paper: BMP1, bone morphogenic protein-1;
Ca-Mg, 1 mmol/L CaCl2 and 1 mmol/L MgCl2; cagPAI, cytotoxin-
associated gene A-Pathogenicity Island; CDX2, caudal-type homeo-
box protein 2; CTGF, conective tissue growth factor; EMT, epithelial-
to-mesenchymal transition; GC, gastric adenocarcinoma; HMLE, hu-
man mammary epithelial cells; HPI, Helicobacter pylori infection; IAP,
intestinal alkaline phosphatase; KRT7, keratin 7; LATS2, large tumor
suppressor 2; MMP9, matrix metalloproteinase 9; mRNA, messenger
RNA; MST1/2, Mammalian Ste20-like kinases 1/2; MUC2, mucin 2; NF-
kB, nuclear factor-kB; RPE1, retinal pigment epithelial cells; RT-qPCR,
reverse-transcription quantitative polymerase chain reaction; siCon-
trol, small interference RNA Control; TEAD, transcriptional enhanced
associated domain; VGLL4, vestigial-like family member 4; WT, wild-
type; ZEB1, Zinc finger E-box-binding homeobox 1.
Most current article
© 2020 The Authors. Published by Elsevier Inc. on behalf of the AGA
Institute. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
2352-345X
https://doi.org/10.1016/j.jcmgh.2019.10.007T cobacter pylori specifically colonizes the stomach of
half the world’s population, provoking a chronic inflamma-
tion of the gastric mucosa that most often is asymptomatic.
However, 10% of infected persons sequentially develop, via
a well-described process known as Correa’s cascade, atro-
phic gastritis, intestinal metaplasia, and dysplastic changes
that can evolve for less than 1% of the cases into gastric
adenocarcinoma (GC).1 GCs are the most frequent stomach
cancers; it ranks third among cancer-related deaths world-
wide.2 H pylori strains positive for the cag pathogenicity
island, which encodes a type 4 secretion system, and the
virulence oncoprotein CagA, are associated strongly with
gastric inflammation and malignancy.3,4 Upon H pylori
adhesion on human gastric epithelial cells, the type 4
secretion system forms a pilus, which translocates CagA and
peptidoglycans into the epithelial cytoplasm, triggering cell
innate immunity and other signaling pathways that alienate
the mucosa homeostasis.5,6
Epithelial turnover, resulting from the balance between
progenitor cell proliferation and differentiated cell death, is
a major host defense mechanism against pathogens and
recurrently is altered during bacterial infections and chronic
in ammatory diseases.5fl In H pylori–infected gastric epithe-
lial cell lines, we previously reported that H pylori via CagA
blocks cell-cycle progression by up-regulating the cell-cycle
regulator large tumor suppressor 2 (LATS2).7 In addition, it
elicits an epithelial-to-mesenchymal transition (EMT)
involving the transcription factor Zinc finger E-box-binding
homeobox 1 (ZEB1).8,9 EMT is characterized by the loss of
epithelial cell polarity and cell–cell interactions, reorgani-
zation of the cytoskeleton, and acquisition of the migratory
properties of mesenchymal cells.10 EMT may contribute to
reduced renewal and aberrant differentiation of the gastric
mucosa in H pylori–infected patients, leading to preneo-
plastic atrophic gastritis and intestinal metaplasia.1
The tumor suppressors LATS1/2, along with Mammalian
Ste20-like kinases 1/2 (MST1/2) and their cofactor Salva-
dor, constitute the kinase core of the Hippo pathway, an
evolutionarily conserved signaling cascade involved in tis-
sue homeostasis, organ size control, and cancers.11 When
the Hippo pathway is activated, thereby restricting tissue
overgrowth, LATS1/2 phosphorylates the transcriptional
coactivator YAP1 on serine-127, leading to its cytoplasmic
retention and proteasomal degradation. On the contrary,
when the Hippo pathway is inactive, nonphosphorylated
YAP1 translocates into the nucleus and acts as coactivator
for the transcription enhancer factors TEADs to promotecell survival and proliferation. The Hippo pathway interacts
with other pathways such as Wingless Int (Wnt)/b-catenin,
Ras, junctional complexes, nuclear factor-kB (NF-kB),
transforming growth factor b, and many others.12,13 Some
Hippo pathway effectors have been reported to be altered in
tumors compared with normal tissue,11,14 including
GCs15–17: down-regulation of LATS1/2 along with over-
expression of the oncogenic YAP1 in the nucleus are
described most often and are associated with aggressiveness
and a poor prognosis. The carcinogenesis processes related
to H pylori infection are not fully understood, although
several mechanisms have been deciphered.18 Here, we aimed
to explore the alterations of the Hippo pathway core
constituted by LATS2 and its substrate YAP1 during H
pylori–induced gastric carcinogenesis; the study of the
LATS2/YAP1 tandem is a novel approach to the carcino-
genesis induced by oncogenic bacteria. Therefore, we used
gastric tissues of either patients or mice at characteristic
stages of the Correa’s cascade upon H pylori infection. We
also used tissue culture systems of human gastric and non-
gastric epithelial cell lines to recapitulate in vitro the early
events of H pylori infection occurring within an actively
replicating gastric mucosa, and to perform infection kinetics
and loss of function studies. We found an unexpected role of
LATS2 in protecting host cells from H pylori–induced gastric
EMT and intestinal metaplasia, a preneoplastic lesion that
confers increased risk for GC development.
Results
LATS2 and YAP1 Are Co-Up-Regulated in the
Gastric Epithelial Cells of H pylori–Infected
Patients or Mice
LATS2 and YAP1 expressions were evaluated and scored
by immunohistochemistry in the gastric mucosa of either
noninfected or H pylori–infected patients at various stages
of Correa’s cascade. LATS2 and YAP1 were strongly up-
regulated and nuclear in gastric epithelial cells of H pylo-
ri–infected patients compared with healthy mucosa, as early
as the gastritis stage, characterized by the presence of
lymphoid infiltrates (Figure 1A) and positive H pylori
staining. LATS2 and YAP1 nuclear overexpression were
2020 LATS2 Controls H pylori–Induced Metaplasia 259found precisely within the isthmus in the fundus and in the
crypts in the antrum, which corresponds to the location of
the regenerative epithelial progenitors, which are stimu-
lated in response to H pylori infection for tissue regenera-
tion.9,19 LATS2 or YAP1 nuclear staining was even stronger
in the glands composing the intestinal metaplasia lesions, in
which the gastric mucosa is replaced by an epithelium
showing intestinal morphology with the presence of
mucous-secreting goblet-like cells (Figure 1A). LATS2 and
YAP1 staining intensities on GC tissue sections were more
heterogeneous than in nontumor tissues, with nuclear
LATS2 directly correlating to nuclear YAP1 overexpression
in intestinal-type GC (Figure 1A and B). Thus, LATS2 and
YAP1 appeared concomitantly overexpressed and nuclear in
gastric epithelial cells in H pylori–associated gastritis, in-
testinal metaplasia, and in GC.
The Correa cascade can be reproduced in a C57BL/6
mouse model force-fed with Helicobacter felis or with
certain proinflammatory strains of H pylori such as the
cytotoxin-associated gene A-pathogenicity island (cagPAI)-
and cagA-positive H pylori HPARE strain (Figure 1C), as
previously described.9,19,20 The exception in these mouse
models is that they do not develop a true intestinal meta-
plasia with goblet cells as in human beings, but a spasmo-
lytic polypeptide expressing metaplasia composed of
mucous-producing cells, replacing parietal and chief cells,
and that can evolve after 1 year into pseudointestinal
metaplasia composed of enterocyte-like cells characterized
by an absorptive intestinal cell morphology in the upper
portion of metaplastic glands.9,19,20 In noninfected mouse
stomachs, both LATS2- and YAP1-nuclear positive cells were
restricted to the isthmus areas, as in human beings. An
intense nuclear expression of LATS2 and YAP1 was noted in
pseudointestinal-type metaplasia, but not in mucinous
metaplasia. This LATS2 and YAP1 colabeling was even
stronger in areas of dysplasia (Figure 1C).The Hippo Pathway Genes Are Affected by H
pylori
For further insight on the dynamics of LATS2 and YAP1
expressions triggered by H pylori, we used the human
gastric epithelial AGS cell line as a model cell system of
replicating gastric mucosa responding to cagA-positive H
pylori strains by proinflammatory mediators and LATS2 up-
regulation,7 along with EMT.8,9 Global gene expression of
AGS in response to H pylori was performed at 24 hours
using whole-genome microarrays. Genes involved in the
Hippo pathway and whose expressions were altered
significantly by the infection are presented in Figure 2A. The
Hippo kinases MST1 and MST1R, but not LATS2 (previously
reported to be posttranscriptionally up-regulated upon H
pylori infection7 and therefore not visible on the tran-
scriptome), were up-regulated approximately twice upon
infection, as well as YAP1, along with vestigial-like family
member 4 (VGLL4), a YAP1-negative competitor for TEAD
binding, which regulates its oncogenic function.21 Other
transcription factors speculated to be interacting with YAP1
were affected variably (TEADs, RUNX1, SMAD3). SeveralYAP1/TEAD target genes involved in cell proliferation and
survival were affected significantly upon infection,
including conective tissue growth factor (CTGF) encoding a
cysteine-rich extracellular matrix protein that functions as
an integrin ligand and activates cell proliferation.12
The Hippo pathway upstream effectors and some com-
ponents of cell polarity complexes and intercellular junc-
tions, which contribute to the activation of the Hippo
pathway,21 were affected modestly upon infection, except
the intercellular junction components CDH1 encoding E-
cadherin, according to our previous report,8 Crumbs Cell
Polarity Complex Component 3 (CRB3) encoding a compo-
nent of the Crumbs complex maintaining the epithelial
integrity,22 and AJUBA encoding a scaffold protein of cell
junctions and binding partner of LATS2.23
Thus, analysis of the Hippo transcriptome in AGS upon
infection combined with our previous report on LATS27
shows concomitant up-regulation of the core kinases,
downstream effector genes, and the YAP1/TEAD target
genes. A closely superimposable gene profile to that of H
pylori–infected AGS cells relative to noninfected cells was
obtained with another human gastric epithelial cell line,
MKN74, which expresses a higher diversity of Hippo genes
than AGS (Figure 2B and C).Biphasic Kinetics of Hippo Activation Upon H
pylori Infection of Gastric Epithelial Cells In Vitro
To assess how LATS2 and YAP1 are orchestrated during
infection, we performed a time course analysis of their
expressions in response to H pylori infection in AGS and
MKN74 cell lines. To circumvent the limitations of the use
of GC-derived cell lines, and because it is not possible to
culture primary gastric epithelial cells in conventional
adherent culture conditions, 2 nontumorigenic immortal-
ized human epithelial cell lines also were used: the retinal
pigment epithelial cells (RPE1) cell line, which is a good
model to study the Hippo pathway,24 and the human
mammary epithelial cells (HMLE) cell line, which has been
widely used to study EMT and the regulation of the Hippo/
YAP pathway.25,26 The cagA-positive wild-type (WT) H py-
lori strain progressively triggered LATS2 and YAP1 accu-
mulation in all cell lines after 2 hours of H pylori infection
(HPI) and until 24 hours of HPI (Figure 3A). This was
associated with an increase of LATS2-mediated YAP phos-
phorylation on Ser127 and of the ratio of YAP-phospho-
Ser127 on total YAP (Figure 3B) and upstream to LATS2
phosphorylation on Thr1041 as shown for HMLE cells,
altogether reflecting LATS2 activation between 2 and 24
hours of HPI. No changes were observed before 1 hour of
HPI in HMLE cells (Figure 3A). Accordingly, LATS2 and
YAP1 immunofluorescence analysis showed a progressively
increasing number of brightly fluorescent cells, in which
both were accumulated in the nucleus: although YAP1 nu-
clear accumulation seems maximal at 2 hours of HPI in all
cell lines and then reduced at 24 hours of HPI, the nuclear
accumulation of LATS2 appears progressively increased
from 2 hours of HPI and up to 24 hours of HPI (Figure 3C
and D). These changes in LATS2 and YAP protein
260 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2
A Healthy mucosa Gastris Intesnal metaplasia Gastric carcinoma
LATS2
YAP1
B 5 YAP1
#
LATS2 * * *
4
H. pylori 3
2
1
0
NI GHp+ IM GC
C H. pylori-infected
Non-infected Metaplasia Dysplasia
Pseudo-IM
LATS2
Mucinous
YAP1
Expressio n Score
2020 LATS2 Controls H pylori–Induced Metaplasia 261expression (Figure 3A) and nuclear localization (Figure 3C
and D) were not observed or strongly reduced at 2, 5, and
24 hours of HPI in cells infected with the cagA-deleted
isogenic H pylori mutant (DcagA). These results were
confirmed by reverse-transcription quantitative polymer-
ase chain reaction (RT-qPCR) data in the 4 cell lines, with
LATS2 and YAP1 messenger RNA (mRNA) overexpressed
progressively upon infection with WT H pylori, but not with
the DcagA mutant (Figure 4A). These results indicate that
LATS2 and YAP1 overexpression and nuclear accumula-
tions upon infection mostly require the virulence factor
CagA (Figures 3A–D and 4A). The variations in LATS2
protein being more important than those in mRNAs are
concordant with a posttranscriptional regulatory mecha-
nism previously described in the AGS gastric cell line.7
Because TEAD is considered to be the primary tran-
scriptional partner of YAP1, we used a TEAD-luciferase re-
porter assay to sense YAP1/TEAD-mediated transcription in
AGS and MKN74 cells challenged by H pylori (Figure 4B).
TEAD transcriptional activity showed biphasic kinetics
characterized by an early and transient stimulation during
the first 2 hours of HPI, followed by decreasing activity from
5 to 24 hours of HPI with WT H pylori. These observations
are in agreement with the YAP1 nuclear accumulation that
appeared maximal at 2 hours of HPI in AGS and MKN74 cells
(Figure 3C and D). The activation of TEAD-luciferase activity
at 2 hours of HPI and its inhibition at 24 hours of HPI are
dependent on CagA because they were not observed in both
AGS and MKN74 cells challenged with the DcagA mutant
(Figure 4B). The changes in the expressions of CTGF and
CYR61, the 2 main YAP1/TEAD target genes,12 paralleled
those of TEAD-luciferase activity with an activation at 2
hours of HPI in AGS, MKN74, and RPE1 cells (Figure 4C),
and repression at 24 hours of HPI in AGS, RPE1, and HMLE
cells (except in MKN74 cells, in which their expression
remained increased at 24 hours of HPI). This was observed
in response to the WT strain but not in response to the
DcagA mutant strain. These results indicate that H pylori
transiently triggered YAP1/TEAD-mediated transcription,
and then progressively repressed it by activating the Hippo
pathway kinase LATS2. It is noteworthy that the activation
of the Hippo/YAP1/TEAD pathway was CagA-dependent
(Figure 4B and C).
At a functional point of view, the Hippo pathway restricts
cell proliferation.11 Indeed, the growth rate of H pylori 7.13
WT-infected AGS at 24 hours of HPI assessed by cellFigure 1. (See previous page). LATS2 and YAP1 expressions i
mucosa. (A) Representative images of the immunohistochemi
mucosa of noninfected individuals (healthy mucosa), and patien
GC. Black arrows indicate nuclear expression of both LATS2 an
notably in gastritis, intestinal metaplasia, and gastric carcinoma
the glands (brown staining). Scale bars: 100 mm. (B) Scores of t
cells determined for H pylori negative (n ¼ 7) and H pylori–posit
(IM, n ¼ 4), or GC (n ¼ 7), from the experiments shown in panel A
Fisher exact test. *P < .05, #P < .01. (C) Representative LATS2 a
C57BL/6 mice and at various stages of the transformation casca
strain. Arrowheads indicate intense nuclear expression of both
mucosa and notably in pseudointestinal-like metaplasia (pseud
LATS2 and YAP1 expression was not increased in mucinous mnumeration was reduced by 73.5% ± 8.0% (n ¼ 4)
compared with noninfected cells, conforming to our previ-
ous report on cagAþ H pylori strains inducing a cell-cycle
arrest in AGS cells at the G1/S transition.7 Similar growth
inhibition also was observed in H pylori 7.13 WT-infected
MKN74 cells (by 42.5% ± 8.4% at 24 hours of HPI and
64.2% ± 7.5% at 48 hours of HPI, n ¼ 3) compared with
noninfected ones. Down-regulation of the S-phase marker
proliferating cells nuclear antigen (PCNA) at 24 hours of HPI
with H pylori 7.13 WT in AGS (reduced to 33.07% ±
10.75%) and MKN74 cells (reduced to 74.04% ± 12.93%)
compared with noninfected ones corroborated the infection-
induced growth inhibition.
Altogether these data show that H pylori transiently
triggered YAP1 expression and activation and YAP1/TEAD
transcriptional activity at 2 hours of HPI, while progres-
sively promoting the accumulation of LATS2, which, phos-
phorylating YAP1 on Ser127, targeted it for proteasomal
degradation and hence inhibited the TEAD-mediated tran-
scriptional activity from 5 to 24 hours of HPI, eventually
contributing to the cell growth inhibition observed in
response to H pylori infection.LATS2 and YAP1 Positively Regulate Each
Other’s Expression in Basal Conditions and in
Response to H pylori
To further assess how LATS2 and YAP1 are regulated in
response to H pylori, we modulated their respective
expression using specific small interfering RNAs or expres-
sion vectors. As expected, siLATS2 successfully knocked
down LATS2 expression and siYAP1 knocked down YAP1
expression in basal conditions and they prevented their
respective overexpression induced at 24 hours of HPI with
H pylori, at both protein and mRNA levels in AGS, MKN74,
and RPE1 cells (Figure 5A and C). LATS2 silencing also
markedly decreased LATS2-mediated YAP1-PSer127 accu-
mulation compared with small interference RNA Control
(siControl) cells (Figure 5A), and increased the YAP/TEAD-
mediated TEAD transcriptional activity (Figure 5D).
Conversely, transfecting a constitutively active LATS2
expression vector7 inhibited TEAD transcriptional activity
by 70% compared with a control vector (plasmid Enhanced
Green Fluorescent Protein, pEGFP), while transfecting vec-
tors encoding either the WT YAP1 (plasmid YAP1, pYAP1)
or a constitutively active, non-phosphorylatable, YAP1S127An H pylori–infected (A and B) human and (C) mouse gastric
stry staining (dark brown) of LATS2 and YAP1 in the gastric
ts with H pylori–associated gastritis, intestinal metaplasia, or
d YAP1 in the isthmus region of the noninfected mucosa and
cells. Arrowheads indicate H pylori detection in the lumen of
he relative percentages of LATS2 and nuclear YAP1-positive
ive patients with gastritis (GHpþ, n ¼ 7), intestinal metaplasia
. The difference between the groups was evaluated using the
nd YAP1 staining on gastric tissue sections from noninfected
de of the gastric mucosa upon infection with H pylori HPARE
LATS2 and YAP1 in the isthmus region of the noninfected
o-IM, enlarged box) and dysplasia observed after 12 months.
etaplasia. Scale bars: 50 mm. NI, non-infected.
262 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2mutant (pYAPS127A) stimulated TEAD activity by 3- and 6-
fold, respectively, in AGS cells, with similar results in
MKN74 cells (Figure 5D). Although YAP1 silencingA AGS
5
4
3
2
1
0
Hippo kinase core Transcription factors Upstream re
Transcription co-factors Target genes Cell polarity
B
MKN7
16
14
12
10
6
4
2
0
Hippo kinase core Transcription factors Upstream r
Transcription co-factors Target genes Cell polarit
C
300
AGS
290
10 MKN74
9
4
3
2
1
0
ore tor
s s  
 c c to
r es s
e a o
r es s
as -f  fa
c n t x n
n o n et 
ge
i u
la ple o
 c o eg m nc

ok g
pp o
n  r  r o  ju
i ip scr
ip Ta m  c r
H r n re
a
ari
ty la
c t l llu
ns sTra Up lpo rc
e
Tra Ce
l e
Int
mRNA relative expression
(fold change relative to non-infected cells) mRNA relative expression
(fold change relative to non-infected cells)
mRNA  relave expression MST1
MST1R MST1
(Infected/Non-infected) LATS1 MST1R
LATS2 MOB1A
SAV1
MOB1A YAP1
TAZ VGLL1
VGLL4 VGLL4
TEAD1 TEAD2
TEAD2 TEAD3
RUNX1
RUNX2 TEAD4
RUNX3 RUNX1
SMAD2 RUNX3
SMAD3 SMAD3
CTGF CTGF
CYR61
CDX2 CYR61
ITGB2 BIRC2
BIRC5 BIRC5
AXL GLI2
SOX4 SOX4
AREG
BBC3 BBC3
SMAD7 SMAD7
SERPINE1 ID2
ID1 NKD1
ID2 CCND1
AXIN1 MYCprevented H pylori–induced activation of TEAD transcrip-
tional activity at 2 hours of HPI, LATS2 silencing prevented
H pylori–induced inhibition of TEAD transcriptional activitygulators Intercellular junctions
complexes
4
egulators Intercellular junctions
y complexes
AXIN2
SNAI2 SOX2
NF2 WBP11
WBP1 WBP2
FRMD6 WBP5
RASSF6
PPP1CB RASSF1
PPP1CC PPP1CB
PPP2R1B PPP1CC
PPP2R2A PPP2R2D
PPP2R2B TP53BP2
TP53BP2 WWC2
WWC1
WWC2 WWC3
WWC3 DLG1
DLG1 DLG3
DLG4 LLGL2
PARD3 PARD3
PARD6B
PARD6G PRKCZ
PRKCI CRB3
PRKCZ AJUBA
CRB3 CDH1
AMOT INADL
AJUBA
CDH1 YWHAE
INADL YWHAZ
MPP5 YWHAB
YWHAE CTNNA1
YWHAH WTIP
YWHAQ
YWHAZ
YWHAB
2020 LATS2 Controls H pylori–Induced Metaplasia 263at 24 hours of HPI, resulting in an increase of the expression
of CTGF and CYR61 YAP/TEAD target genes in AGS, MKN74,
and RPE1 cells at 24 hours of HPI (Figure 5E and F). Un-
expectedly, LATS2 silencing also decreased YAP1 expression
in basal conditions (Figure 5A) and prevented H pylori–in-
duced YAP1 overexpression at 24 hours of HPI at the pro-
tein and/or mRNA levels in AGS, MKN74, and RPE1 cells
(Figure 5A and C). Reciprocally, YAP1 silencing down-
regulated LATS2 expression at the protein and/or mRNA
levels in AGS, MKN74, and RPE1 cells (Figure 5A and C).
These results suggest that in basal conditions LATS2, similar
to CTGF and CYR61, may depend on YAP1/TEAD tran-
scriptional activity. Collectively, these data confirm on one
hand the canonical function of YAP1 as a mandatory TEAD
transcription cofactor in these models, and on the other
hand they stress an unexpected correlation of LATS2 and
YAP1 expressions beyond their kinase-substrate
relationship.
All combined, these data show that in basal conditions as
well as in response to H pylori, (1) YAP1 is a major coac-
tivator of TEAD-mediated transcription at 2 hours of HPI,
(2) that it is prominently controlled by LATS2-mediated
YAP1 phosphorylation and targeting for degradation at 24
hours of HPI, and, remarkably, (3) that LATS2 and YAP1
reciprocally positively regulate each other’s expression. This
last conclusion was supported further by data on other
gastric epithelial cell lines, which show a strict co-
expression of YAP1 and LATS2 (Figure 5B).LATS2 Restricts the H pylori–Induced EMT
We observed that either YAP1 or, to a lesser extent,
LATS2 silencing hampered the AGS and RPE1 growth rate in
basal conditions (reduced by 41% ± 5% [P < .05 vs
respective siControl cells] with siYAP1 and 30% ± 12% [P <
.05 vs respective siControl cells] with siLATS2 compared
with siControl at 30 hours in AGS cells, and by 39% ± 8% [P
< .05 vs respective siControl cells] with siYAP1 and 6% ±
15% with siLATS2 compared with siControl at 30 hours in
RPE1 cells). This suggests that the LATS2/YAP1 tandem
may be required for optimal cell growth in tissue culture.
Moreover, we noticed in AGS that some siLATS2 cells ac-
quired the EMT-characteristic hummingbird phenotype, and
that siLATS2 significantly increased the percentage of
hummingbird cells induced by H pylori at 24 hours of HPI
(Figure 6A and B). Similar results were observed in MKN74,
in which the rounded cells undergoing EMT (as previously
described8) was increased in siLATS2 cells compared with
siControl cells (Figure 6A). The mesenchymal phenotype
observed in siLATS2-treated cells was associated with ZEB1Figure 2. (See previous page). Expression of the Hippo path
human gastric epithelial cells. (A and B) Microarray
pathway–associated genes in response to H pylori 7.13 WT infe
genes correspond to yellow bars, transcriptional co-factors to
Hippo upstream effectors to blue bars, components of the c
junctions to red bars. (C) Relative expression of the differenti
infection in AGS and MKN74 gastric epithelial cell lines was de
lyses. Bars indicate medians. (A–C) Only genes with statistically
t test with Benjamini–Hochberg correction). LATS2 was not expup-regulation and nuclear accumulation compared with
siControl, in both basal and infected conditions in AGS,
MKN74, and RPE1 cells (Figure 6C and D). Noticeably,
LATS2 silencing also drastically up-regulated other mesen-
chymal effectors such as the matrix metalloproteinase-9
(MMP9) and the bone morphogenic protein-1 (BMP1)
(Figure 6C and E). Exacerbated EMT upon LATS2 silencing
was confirmed by increased invasive properties in both
basal and H pylori–infected conditions compared with
siControl in AGS and MKN74 cells and in basal conditions in
RPE1 cells (Figure 6F). On the contrary, exogenous plasmid-
LATS2 (pLATS2) slowed down basal AGS invasive capacities
(Figure 6F). Collectively these results support a role of
LATS2 in contributing to the basal epithelial phenotype in
gastric epithelial cell lines as well as in RPE1 epithelial cells
and in constraining H pylori–promoted EMT.
LATS2 Controls the H pylori–Induced Metaplasia
Phenotype
Next, we analyzed the changes in expression of highly
specific markers of intestinal metaplasia in gastric AGS
and MKN74 cells. The expression of the caudal-type ho-
meobox protein 2 (CDX2), mucin 2 (MUC2), and intestinal
alkaline phosphatase (IAP) was evaluated in siControl and
siLATS2 AGS cells challenged by WT H pylori. CDX2 is a
critical actor in the development of intestinal meta-
plasia.27 As an intestine-specific transcription factor,
CDX2 regulates goblet-specific MUC2 gene expression,
resulting in the differentiation of intestinal epithelium.28
IAP, a brush-border protein expressed exclusively in
differentiated enterocytes, is a host defense mechanism
preventing bacterial invasion across the gut mucosal
barrier.29 AGS cells heterogeneously expressed CDX2
detected by immunofluorescence in the nucleus in basal
conditions (Figure 7A and C). The percentage of CDX2-
positive cells increased by more than 2-fold in response
to infection in siControl cells, and by more than 5-fold
and 6.5-fold in noninfected and infected, respectively,
siLATS2 cells (Figure 7A and C). Accordingly, CDX2 mRNA
was up-regulated in infected siControl cells, as well as in
both noninfected and infected siLATS2 AGS cells,
compared with noninfected siControl cells (Figure 7D).
However, CDX2 upregulation could not be confirmed in
siLATS2 MKN74 cells (Figure 7E). MUC2 immunofluores-
cent staining was heterogeneous and mostly nuclear in
noninfected siControl cells, as previously reported in AGS
cells,30 and its overexpression in siLATS2 cells in basal
and infection conditions paralleled those of CDX2 both at
the protein and the mRNA level in AGS cells (Figure 7Away genes upon 24 hours of H pylori infection of cultured
-based identification of differentially expressed Hippo
ction in (A) AGS cells and (B) MKN74 cells. Hippo kinase core
purple bars, YAP1/TAZ/TEAD target genes to orange bars,
ell polarity complexes to light green bars, and intercellular
ally expressed Hippo-related genes in response to H pylori
termined according to microarray-based transcriptome ana-
significant changes in expression are shown (n ¼ 4; P < .05 in
ressed differentially in AGS cells upon infection.
264 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2
A MKN74 RPE1
+ H. pylori 7.13 + H. pylori 7.13
WT ΔcagA WT ΔcagA
- - 2h 5h 24h 2h 5h 24h2h 24h 2h 24h
LATS2 LATS2
1 1,40* 1,35* 1,50 1,25 1 0,69 0,81 2,54 0,37 0,94 1,60
YAP-PSer127 YAP1
1 1,48 3,68* 1,07 0,99
YAP1 1 0,98 1,09 1,25 0,83 0,99 0,89GAPDH
1 2,00* 1,84* 1,36 1,01
α-tubulin
AGS + H. pylori 7.13 HMLE + H. pylori 7.13 WT
WT ΔcagA - 1h 2h 5h 24h
- Thr10412h 24h 2h 24h LATS2-P
LATS2 1 2,78 4,56 10,32 11,21
1 3,70* 1,56* 1,17 0,24 LATS2
YAP-PSer127 1 0,85 0,85 0,70 0,50
Ser127
1 1,88 2,70* 0,84 0,55 YAP-P
1 0,84 1,86 3,17 4,11
YAP1
YAP1
1 2,72* 2,41* 1,51 1,01
1 1,18 1,13 1,26 1,60
α-tubulin α-tubulin
B YAP-PSer127/YAP D
3.0 RPE1 HMLE
2.5 AGS
2.0 MKN74 LATS2 (Green) YAP1 (Green) LATS2 (Green) YAP1 (Green)
RPE1
1.5
HMLE
-
1.0
0.5
- 1h 2h 5h 24h
+H. pylori7.13 WT
2h
C AGS MKN74
LATS2 (Green) YAP1 (Green) LATS2 (Green) YAP1 (Green)
- 5h
2h 24h
24h 2h
5h
2h
24h
24h
H. pylori 7.13 ∆CagA H. pylori 7.13 WT
Fold change relave to
non-infected control cells
H. pylori 7.13 ∆CagA H. pylori 7.13 WT
2020 LATS2 Controls H pylori–Induced Metaplasia 265and D). IAP enzymatic activity appeared as cytoplasmic
blue foci in AGS cells; the percentage of cells showing IAP
foci was increased upon infection and particularly in
siLATS2 infected cells, along with larger and more intense
foci (Figure 7B and C).
Other intestinal metaplasia markers such as keratin 7
(KRT7) and Sox9 transcription factor have been reported to
be associated with H pylori–induced metaplasia,31 and KRT7
also was found to be up-regulated in response to H pylori
and to LATS2 silencing in AGS (Figure 7D). Thus, the sig-
nificant overexpression of MUC2, CDX2, IAP, and KRT7 in
siLATS2 infected AGS cells compared with siControl infected
cells confirms that LATS2 silencing exacerbated H pylo-
ri–induced expression of markers of intestinal metaplasia in
this particular cell line. As far as MKN74 cells are concerned,
in which LATS2 silencing did not affect CDX2 expression but
clearly up-regulated Sox9 (Figure 7E), the gastric-specific
mucin-5AC (MUC5AC), which is well expressed in MKN74
cells but not in AGS cells (data not shown), was down-
regulated in MKN74 cells upon infection and further
decreased in infected or noninfected siLATS2 cells
(Figure 7E), signifying a loss of gastric epithelial differenti-
ation markers.
All combined, these data indicate that LATS2, while
controlling H pylori–promoted EMT, also constrains the in-
testinal transdifferentiation endorsed by the infected gastric
epithelial cells.Discussion
Epithelia exposed to environmental assaults, including
pathogen infection, require constant cell renewal and
signaling tuning to maintain tissue homeostasis. Upon con-
tact and molecular communication with its host, mainly
through the cagPAI-encoded effectors, H pylori manipulates
host signaling cascades. This occurs by either modulating or
hijacking specific intracellular signal transduction compo-
nents, thereby undermining host defenses and establishing
chronic infection and gastric diseases at high oncogenic risk.
The Hippo pathway, an evolutionary conserved signaling
cascade regulating tissue growth and homeostasis through
the downstream core kinase/effector tandem constituted by
LATS1/2 and YAP1, is not fully understood in H pylori
infection. We previously reported that carcinogenic strains
of H pylori up-regulated the tumor-suppressor LATS2,7 and
increased EMT features8,9 in gastric epithelial cells. The roleFigure 3. (See previous page). Expression and subcellular loc
expressions in cultured gastric and nongastric cells. Time co
in nongastric noncancerous epithelial cells (HMLE and RPE1) in
isogenic mutant (DcagA) strain for different time periods during
PSer127 protein levels were analyzed by Western blot in noninfec
with WT H pylori and at 24 hours of HPI with the cagA-deleted is
is shown. The number under each band corresponds to the v
housekeeping protein (glyceraldehyde-3-phosphate dehydroge
MKN74 cells. (B) Graphic representation of the ratio of YAP-PSe
WT in the 4 cell lines. (C and D) Representative images of the e
green) evaluated by immunofluorescence in (C) AGS and MKN7
RPE1 and HMLE nongastric noncancerous epithelial cell lin
phalloidin–Alexa Fluor–546 (in red) and nuclei were marked withof LATS2 and its oncogenic target YAP1 remain to be clar-
ified during the preneoplastic steps of H pylori–induced
gastric carcinogenesis, including metaplasia development.
Our data show that the Hippo pathway is an additional
signaling cascade triggered in host cells in response to H
pylori in a CagA-dependent manner. Moreover, they stress a
prominent role of LATS2 in allowing the host cells to resist
the H pylori–mediated transdifferentiation of the gastric
epithelium, characterized by the acquisition of both EMT
and intestinal metaplasia markers.LATS2 and YAP1 Interdependence in H
pylori–Infected Gastric Mucosa
In our study, we found LATS2 and YAP1 concomitantly
up-regulated in the nuclei of the epithelial cells in the
gastric mucosa of both patients and mice chronically
infected with H pylori, as soon as the gastritis stage and
increasingly in the preneoplastic lesions of intestinal
metaplasia preceding adenocarcinoma development. They
both were strongly, still heterogeneously, expressed in
intestinal-type GC. These observations were unexpected in
regard to most data reporting an inverse correlation of
LATS1/2 and YAP1 expressions in many tumor cells.11,14
The overexpression of the oncogenic YAP1 was reported
to portend a poor prognosis in GC.15–17 YAP1 is strikingly
essential to stimulate cell growth when they are stirred
up to ensure tissue regeneration,32–35 a condition fulfilled
during H pylori assault of the gastric mucosa. In turn,
LATS2 acts as a brake of the stimulated growth, phos-
phorylating and targeting YAP1 for proteasomal degra-
dation and thereby ensuring optimal organ size. By using
AGS and MKN74 gastric epithelial cell lines as well as
HMLE and RPE1, 2 nongastric immortalized epithelial cell
lines, challenged by H pylori in vitro, we found that H
pylori via CagA affects LATS2 and YAP1 expression and
activity in a coordinated biphasic pattern, characterized
by the following: (1) by an early and transient YAP1 nu-
clear accumulation along with stimulated YAP1/TEAD
transcription at 2 hours of HPI, (2) followed by nuclear
LATS2 up-regulation leading progressively to YAP1
phosphorylation from 2 to 24 hours of HPI, (3) which
correlated with a progressive decrease and repression at
24 hours of HPI of TEAD transcriptional activity and
expression of CYR61 and CTGF target genes. In vitro, this
quick wave of YAP1/TEAD activation may be rapidlyalizations of H pylori–induced changes in LATS2 and YAP1
urse analyses were performed in gastric AGS and MKN74 and
fected with the H pylori 7.13 WT strain and the cagA-deleted
24 hours. (A) LATS2, LATS2-PThr1041, total YAP1, and YAP-
ted cells, at the indicated time periods during 24 hours of HPI
ogenic mutant. A representative blot of 3 or more experiments
alue of the relative protein quantification normalized to the
nase [GAPDH] or a-tubulin). *P < .05 vs noninfected AGS or
r127 on total YAP1 during kinetics of infection of H pylori 7.13
xpression and subcellular localization of LATS2 and YAP1 (in
4 gastric epithelial cells at 2 and 24 hours of HPI, and (D) in
es at 2, 5, and 24 hours of HPI. Actin was marked with
4’-6-diamino-phenyl-indol (in blue). Scale bars: 10 mm.
266 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2
A H. pylori 7.13 WT
L A T S 2 Y A P 1
8 A G S M K N 7 4 R P E 1 H M L E 4 A G S M K N 7 4 R P E 1 H M L E
6 * * * * * * *
4 * 3
2 *
2 * ** * * * * * *
1
1 $ $
$ $ * *
0 0
+ H . p y lo ri + H . p y lo ri
7 .1 3  W T 7 .1 3  W T
H. pylori 7.13 ∆cagA
L A T S 2 Y A P 1
3 A G S M K N 7 4 R P E 1 H M L E 6 A G S M K N 7 4 R P E 1 H M L E
2 4
1 2
$ $ $ $ $
0 0
+ H . p y lo ri + H . p y lo ri
7 .1 3 ∆ c ag A 7 .1 3 Δ c ag A
B A G S  T E A D L u c M K N 7 4  T E A D L u c
4 2h 5h 2 4 h 4 2h 5h 2 4 h
# # # # #
*
3 3 *
##
2 2
1 * 1 * *
* * * *
0 0
W T g A W T g A W T g A W T g A T A T A
C Δ c a aΔ c Δ c a c a
W a gc W a
g
Δ Δ Δ c
H. pylori 7.13 WT
C T G F C Y R 6 1
3 A G S M K N 7 4 R P E 1 H M L E A G S M K N 7 4 R P E 1 H M L E
* * 2 .5
2 .0 *
2 * * ** ** * * * * *1 .5
* * * * *
1 .0 *
1
* * * * * *
* 0 .5 * *
$ * * $ $ $0 0 .0
+ H . p y lo ri + H . p y lo ri
7 .1 3  W T 7 .1 3  W T
H. pylori 7.13 ∆cagA
C T G F C Y R 6 1
2 .0 A G S M K N 7 4 R P E 1 H M L E 4 A G S M K N 7 4 R P E 1 H M L E
* *
1 .5 * 3
1 .0 * 2
* ** *
0 .5 1
$ $ $ $
0 .0 0
+ H . p y lo ri + H . p y lo ri
7 .1 3 Δ c ag A 7 .1 3 Δ c ag A
m R N A  e x p r e s s io n  r e la t iv e  t o m R N A  e x p r e s s io n  r e la t iv e  t o m R N A  le v e l r e la t iv e  t o m R N A  le v e l r e la t iv e  t o
n o n - in f e c t e d  c e lls n o n - in f e c t e d  c e lls
n o n - in fe c te d  c o n tr o l c e lls n o n - in fe c te d  c o n tr o l c e lls
1
1 hh 2 h T E A D  t r a n s c r ip t io n a l a c t iv it y 12 h
1 h
h 5 h r e la t iv e  t o  n o n - in f e c t e d  c e lls 2 25
2 h
2 4 h h
4 h 5 h 5h 2 4 2
h
1 h 4 h
1 hh 2
2 hh 5 1 h 1 h
5 h 2
h
4 2 22 4 h h hh 5 h 51 2 2 h
1 h 4 4h 2 h h
2 hh 5
5 h 1 1
2 h
2 4 h h
4 h 2 h 2h h
1 h 5 h 51 hh 2 2 4 2 4
2 h hh 5 h
5 h 2
h
2 4 h 14 h
1 h
h 2 h 2 h
5 5
2 h4 2
h
h 4 h
m R N A  e x p r e s s io n  r e la t iv e  t o m R N A  le v e l r e la t iv e  t o m R N A  le v e l r e la t iv e  t o
m R N A  e x p r e s s io n  r e la t iv e  t o
n o n - in f e c t e d  c e lls
n o n - in f e c t e d  c e lls n o n - in fe c te d  c o n tr o l c e lls n o n - in fe c te d  c o n tr o l c e lls
1 h 1 1 h 1h h
2 h 2 T E A D  t r a n s c r ip t io n a l a c t iv it yh 2 h 2 h
5 h 5 h r e la t iv e  t o  n o n - in f e c t e d  c e lls2 5 h 54 2 hh 4 h 2 4 2h 4 h
1 h 1 h
2 1 1h 2 h hh
5 5 2 2
2 h 2 h
h h
4 h 4
5 5
h 2 h 2 h4 h 41 1 hh h
2 h 2 h 1 h 15 hh 52 2 h 2 h 24 4 hh h 5
2 h
5
1 2
h
h 1 h 4 h 4 h
2 h 2 h
5
2 h
5 1 1
2 h
h h
4 h 4 h 2 h 2 h
5
2 h
5
2 h4 h 4 h
2020 LATS2 Controls H pylori–Induced Metaplasia 267controlled by LATS2 induction in response to H pylori.
Unlike LATS2, LATS1 could not be detected by RT-qPCR in
AGS and MKN74 cell lines (unpublished data), suggesting
that LATS1 probably plays a minor role in the response to
H pylori, contrarily to LATS2. In addition, Furth and
Aylon36 reported that although LATS1 protein is detected
throughout most tissues, LATS2 protein levels seem to
vary, with the highest expression in the gastrointestinal
tract and the brain. In vivo, chronic infection and
inflammation of the gastric mucosa by H pylori could lead
to constant waves of YAP1/TEAD activation and LATS2
induction that may result in the observed YAP1–LATS2
nuclear co-overexpression, preceding neoplastic trans-
formation and maintained in the growing GC. Interest-
ingly, LATS2 and YAP1 overexpression in nontumor
tissues were found precisely within the isthmus of the
fundus and in the crypts of the antrum, where the stem
cell marker CD44 also was overexpressed, and that cor-
responds to the regenerative epithelial stem cell loca-
tion.18 This co-overexpression may show an extension of
the gastric stem cell reservoir, which, in the context of H
pylori–triggered chronic inflammation, acquires mesen-
chymal, intestinal, and preneoplastic features.
The siLATS2- and siYAP1-mediated loss-of-function
experiments showed that knocking down one weakens
the expression of the other, suggesting that LATS2 and
YAP1 reciprocally maintain each other’s expression and
activity in both basal and infected conditions. Moroishi
et al37 reported that YAP1/TEAD directly induces LATS2
transcription upon binding to its promoter. LATS2 in turn
phosphorylates YAP1 on Ser127, leading to its targeting for
proteasomal degradation: this negative feedback loop
likely is responsible for the transient and tightly controlled
YAP1/TEAD activation in H pylori–challenged gastric and
nongastric epithelial cells in vitro, despite the over-
expression of YAP1 and its nuclear localization at 24 hours
of HPI. For instance, nuclear YAP1 also can associate with
repressors such as VGLL4,24 RUNX1, and RUNX3,38,39
which by binding YAP1 inhibit its association with the
TEADs and the subsequent TEAD-mediated transcriptional
activity. Interestingly, VGLL4 and RUNX1 were found two-
fold increased in the transcriptome of AGS and MKN74
cells at 24 hours of HPI (Figure 2). Therefore, it cannot
be excluded that the overexpression of these negative
regulators of YAP1/TEAD interaction also could
participate in the observed effects at 24 hours of HPI.
The YAP1/TEAD-dependent transcription of LATS2
also is supported by the strong correlation of LATS2 and
YAP1 protein in other gastric epithelial cell lines.
Therefore, LATS2 could be considered a YAP1 target
gene involved in a negative feedback loop to tightlyFigure 4. (See previous page). Biphasic kinetics of H pylo
cultured gastric and nongastric cells. (A) Relative mRNA levels
hours of HPI with H pylori 7.13 WT and DcagA strains in AGS,
TEAD-luciferase reporter activity with H pylori 7.13 WT and Dcag
YAP1/TEAD target genes CTGF and CYR61, assessed by RT-q
strains. (A–C) Bars represent means ± SEM of fold changes relat
< .001 vs noninfected, using the Kruskal–Wallis test. $Unavailacontrol YAP1/TEAD oncogenic activity while partly
maintaining YAP1 expression. The LATS2/YAP1 interde-
pendence also could explain the impaired cell growth in
siLATS2 AGS cells, contrarily to enhanced growth that
could be expected after knockdown of a tumor-
suppressor gene.
At last, one open question is how LATS2 and YAP1 are
alerted by H pylori infection. In addition to MST1/2, which
was up-regulated 2-fold in AGS and MKN74 cells (tran-
scriptomic analyses) (Figure 2) and induces LATS2 phos-
phorylation on Thr1041 and its subsequent activation
(Figures 3 and 5), LATS2 is subject to regulation by
numerous proteins, including Mitogen-associated protein
kinase 4 (MAPK4), AURORA-A, and AJUBA, Neurofibroma-
tosis 2 (NF2)/Merlin, and CRB3,11,40–42 which were found to
be up-regulated in the transcriptome of infected gastric
epithelial cells (Figure 2). Moreover, mechanical signals
related to the microenvironment represent an additional
pillar for YAP1 function.12,34,43 CagA, through its ability to
bind to several host cell junction proteins, deeply de-
stabilizes gastric epithelial cell–cell junctions and cell shape,
as evidenced by the hummingbird phenotype that AGS show
at 24 hours of HPI.8,9,44–46 It is noteworthy that CagA targets
and triggers the Src-homology phosphatase-2 (SHP-2),
which directly interacts with YAP1 and potentiates its
cotranscriptional function.47,48 This tripartite connection of
CagA/SHP2/YAP1 may be critical in the early phases of
human gastric carcinogenesis.49 Nuclear localization of
YAP1 is thus the sum of multiple, possibly parallel, regula-
tory layers.LATS2 Constrains EMT and Intestinal Metaplasia
in Infected Gastric Epithelial Cells
The oncogenic cascade leading to gastric carcinoma in
chronically H pylori–infected gastric mucosa involves a
transdifferentiation process termed the intestinal meta-
plasia, in which the gastric mucosa aberrantly differentiates
into an intestinal mucosa, both morphologically and func-
tionally.1,4 We previously reported that this aberrant
differentiation generated by the H pylori–mediated inflam-
matory context starts by the loss of epithelial features at the
profit of mesenchymal ones, although the mucosa exacer-
bated some epithelial features (namely, the micro RNA miR-
200 and E-cadherin expressions), which allowed it to thwart
the irreversible loss of epithelial identity and resist total
allostasis.8
LATS2 silencing increased YAP1/TEAD-mediated the
oncogenic transcriptional program (objectified here
by CTGF and CYR61 up-regulation under basal and H
pylori–infected conditions) and exacerbated the Hri–induced changes in LATS2 and YAP1 expressions in
for LATS2 and YAP1 assessed by RT-qPCR at 1, 2, 5, and 24
MKN74, RPE1, and HMLE cell lines. (B) Biphasic kinetics of
A at 2, 5, and 24 hours of HPI. (C) Relative mRNA levels for the
PCR, in kinetics of infection with H pylori 7.13 WT and DcagA
ive to noninfected cells, 3< n < 6. *P < .05, **P < .01, and ***P
ble data.
268 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2
A + H. pylori
AGS MKN74 + H. pylori
LATS2
1 0,22 0,19 0,64 1,41 1,40 0,22 0,45 0,98 0,74 LATS2
YAP-P 1 0,25 0,20 1 1,19 0,25 0,59Ser127
YAP1-PSer127
1 0,18 0,19 0,28 1,27 1,92 0,24 0,48 1,14 1,44 1 0,07 0,06 1 1,58 0,17 0,89
YAP1 YAP1
1 0,36 0,35 0,88 1,22 1,53 0,56 0,61 0,95 0,62 1 0,13 0,31 1 1,46 0,55 1,06
GAPDH α-tubulin
+ H. pylori
RPE1 B
+ H. pylori
LATS2-PThr1041
1 0,76 1,08 1,67 0,76 0,95 AGS KatoIII NCI87 MKN74
LATS2 LATS2
1 0,44 1,07 5,39 1,23 1,05 1 1,41 0,48 1,16 1,29 0,62
YAP-PSer127 YAP1
1 0,52 0,80 1,59 0,49 0,78 1 0,18 0,05 1,83 0,15 0,06 α-tubulin
YAP1
1 0,69 1,09 3,03 0,77 1,23 1 0,16 0,05 1,12 0,07 0,02
GAPDH
C Y A P 1 L A T S 2
2 .5 A G S M K N 74 R P E 1 3 A G S M K N 74 R P E 1
2 .0 #
2
1 .5
1 .0
* * 1* * * *
0 .5
* * * * * *$ $ $ $ *
0 .0 0
tr l -1 -2 -1 -2 tr l -1 -2 -1 -2 tr l -1 -2 -1 -2 tr l -1 -2 -1 -2 l 1 2 1 2 l2 2 1 1 2 2 1 1 2 2 1 1 2 2 1 1 tr 2 - 2 - 1 - 1 - tr 2 -
1 -2 -1 -2
iCs T S T S A P A P s i
C
T S T S P P
C
A A s i T S T S A P A P i
C S S P P iC S S P P iC S S 2s T T A A s T T A A s T T A P
1 P 1
L A L A iY iY L A L A iY iY L A L A iY iY L A L A iY iY A
A
i i s s i i s s i i s s i i s s iL iL
A iY iY L A L A iY iY
s s s s s s s s s s s s s i s i s s
D AA G SS M KKNN7474 E A MKN74
2 5 A
GGSS M K N 7 4
2 0 * 4 * *
1 5 * # * 2h
*
* 2 4 h3
6 *
4 * * 2 * #
* *
2 1
#
* $0 0 $ $
r l 2 1 P 2 1 A r l 2 1 P 1 A tr l 1 1 r l 1 1 r l 1 1 l
C t
1
T S A P F S P
- - t - - t -
T 2 7 C
t S P F P 2 7 iC S 2 P 1 iC S 2 P 1 iC S 2 P 1
- r -1 -
i G iC
t
S 2 P 1
s L A iY E L A p Y
A 1 Ts i A Y Ai E G Y
A 1 sS S A T Y A
s
A T A
s T A s T A
i s p p P iL ps s s p P s iL s
i L s iY L A s iY A Y
A A s i s i s i
L s i
F p
Y p Y + H . p y lo r i + H . p y lo r i
C T G F C Y R 6 1
1 0 A G S M K N 74 R P E 1 8 A G S M K N 74 R P E 1
* * * * * * * *
8
6
6
4
4
*
2 * * 2 * *
* * *
*
$ $ $ $
0 0
tr l 2 -
1
2 -
2
1 -
1 -21 tr
l 1 2 1 2
2 - 2 - 1 - 1 - tr
l -1 -22 2 1 -
1
1 -
2 tr l -1 -2 -1 -2 tr l -1 -2 -1 -2 r l -1 -2 -1 -2
iC S S P P iC S S P P iC S S P P iC S 2 S 2 P 1 P 1 iC S 2 S 2 P 1 P 1 iC
t 2 2 1 1
s T T A A s s s s s SA A Y Y A T A T Y A Y A A T A T Y A Y A A T A T Y A Y A A T A T Y A Y A A T A T
S A P P
L L i i L L i i L L i i L L i i L L i i L L iY Y
A
s i s i s s s i s i s s s i s i s s s i s i s s s i s i s s s i s i s s
i
R e la t iv e T E A D
t r a n s c r ip t io n a l a c t iv ity
m R N A r e la t iv e e x p r e s s io n m R N A r e la t iv e e x p r e s s io n
( In fe c t e d / N o n - in f e c t e d ) ( In fe c t e d / N o n - in f e c t e d )
T E A D T r a n s c r ip t io n a l a c t iv ity
r e la t iv e to s iC o n tr o l
m R N A r e la t iv e e x p r e s s io n m R N A r e la t iv e e x p r e s s io n
( In fe c t e d / N o n - in f e c t e d ) ( In fe c t e d / N o n - in f e c t e d )
2020 LATS2 Controls H pylori–Induced Metaplasia 269pylori–induced EMT phenotype, as shown by characteristic
alterations in cell morphology, induction of the mesen-
chymal marker ZEB1, and the proteinases MMP9 and BMP1,
which likely may be involved in the increased invasion ca-
pacities. Interestingly, ZEB1 mechanistically and function-
ally binds to YAP1, promoting the expression of a common
ZEB1/YAP1 target oncogene set, including CTGF and
CYR61,50 the up-regulation of which in siLATS2 AGS cells
could be mediated not only by YAP1/TEAD, but also by
YAP1/ZEB1 as well. ZEB1 is also a NF-kB target gene during
H pylori–induced EMT in gastric epithelial cell lines.8 ZEB1
up-regulation, induced by siLATS2, could be explained by an
indirect action of LATS2 via NF-kB, which was found to be
regulated negatively by LATS2 in non–small-cell lung car-
cinoma.51 In addition, silencing LATS2 in nontransformed
HMLE mammary epithelial cells increased NF-kB association
with p53, thereby promoting cell migration.52
Similar to EMT, intestinal metaplasia is an aberrant dif-
ferentiation that can be partly mimicked in the cultured
gastric cell system challenged by WT H pylori, as shown by
the up-regulation of the intestinal metaplasia markers CDX2,
MUC2, IAP, and KRT7 in AGS cells and up-regulation of the
intestinal metaplasia marker SOX9 and down-regulation of
the gastric-specific MUC5AC in MKN74 cells. CDX2 may be
stimulated by interleukin 6 via the signal transducer and
activator of transcription 3 pathway53 and also by some
mesenchymal effectors such as BMP1,54 which was shown
here to be up-regulated upon infection and upon LATS2
silencing in both AGS and MKN74 cells.
In conclusion, during the time course of H pylori
infection, which interrupts the integrity of the gastric
mucosa and provides access to its oncogenic effector CagA
to many host cell signaling components, a number of
specific signal transmissions are engaged through the
different cell compartments.55 The tumor-suppressor
Hippo LATS2/YAP1/TEAD signaling is one of them: the
co-overexpression of nuclear LATS2 and YAP1 detected in
H pylori–associated gastritis and metaplastic tissues sug-
gests that an equilibrium exists in vivo between active
YAP1 and LATS2-mediated YAP1 targeting for degradation
that could maintain gastric epithelial cell differentiationFigure 5. (See previous page). LATS2 and YAP1 regulate each
infection. (A) Western blot analysis of LATS2, LATS2-PThr1041,
RPE1 cells infected or not with the 7.13 WT H pylori (24 hours o
RNAs, either negative control (siCtrl), or against LATS2 (siLAT
numbers under each band correspond to the quantification o
housekeeping protein glyceraldehyde-3-phosphate dehydrogen
basal expression determined by Western blot in AGS, MKN7
(C) Relative mRNA levels of YAP1 and LATS2 expression in siRN
noninfected cells (ratio of mRNA levels in H pylori–infected cells
noninfected AGS and MKN74 cells at 30 hours after transfection
and pYAP-S127A. (E) Quantification of the TEAD-luciferase repo
respectively, to 8 and 30 hours after the last siRNA transfection
and CYR61 expression in siRNA-transfected cells at 24 hours
levels in H pylori–infected cells vs noninfected cells). (C and F) Th
siControl cells. Bars represent the mean fold changes ± SEM, 3
siControl infected/noninfected cells using the Kruskal–Wallis tes
(D and E) Bars represent the mean fold changes ± SEM, 3 < n <
cells using the Kruskal–Wallis test. $Unavailable data. siCtrl, siCand survival in the infected and inflamed mucosa. In the
host–pathogen conflict, which generates an inflammatory
environment, cell damage, and perturbation of epithelial
turnover and differentiation, it appears as a protective
pathway limiting the loss of gastric epithelial identity that
precedes adenocarcinoma development. This manipula-
tion also may be beneficial to H pylori colonization and
chronic infection.
Materials and Methods
Ethic Statements on Human and Mouse Tissue
Samples
Studies on paraffin-embedded tumors and distant non-
tumor tissues from gastric adenocarcinoma patients were
performed in agreement with the Direction for Clinical
Research and the Tumor and Cell Bank of the University
Hospital Center of Bordeaux (Haut-Leveque Hospital, Pessac,
France) and were declared at the French Ministry of Research
(DC-2008-412). Animal experiments have been performed in
level 2 animal facilities of the University of Bordeaux
(France), with the approval of institutional guidelines deter-
mined by the local Ethical Committee of the University of
Bordeaux and in conformity with the French Ministry of
Agriculture Guidelines on Animal Care and the French Com-
mittee of Genetic Engineering (approval number 4608).
Human Gastric Tissues
Paraffin-embedded gastric tissue samples (tumors and
noncancerous mucosa) from consenting patients (both
sexes; age, 68–85 y) undergoing gastrectomy for distant
noncardia adenocarcinoma were included in the study, in
agreement with the tumor bank of the Bordeaux University
Hospital (France), as previously reported.17
Gastric and Nongastric Epithelial Cell Culture
The AGS (ATCC CRL-1739), MKN74 (HSRR Bank
JCRB0255), NCI-N87 (ATCC CRL-5822) and Kato-III
(ATCC HTB-103) cell lines established from human GC
were cultured in Dulbecco’s modified Eagle medium/
F12-Glutamax or RPMI1640-Glutamax media for MKN74,other both in basal conditions and in response to H pylori
YAP1, and YAP-PSer127 protein levels in AGS, MKN74, and
f HPI) 30 hours after the last transfection with small interfering
S2-1 and siLATS2-2) or YAP1 (siYAP1-1 and YAP1-2). The
f the relative protein expression normalized to that of the
ase (GAPDH) or a-tubulin. (B) Comparison of LATS2 and YAP1
4, NCI-87, and Kato III human gastric epithelial cell lines.
A transfected cells at 24 hours of HPI with H pylori 7.13 WT vs
vs noninfected cells). (D) TEAD-luciferase reporter activity in
with siCtrl, siLATS2, siYAP, pEGFP (control), pLATS2, pYAP1,
rter activity measured at 2 and 24 hours of HPI corresponding,
in AGS and MKN74 cells. (F) Relative mRNA levels of CTGF
of HPI with WT H pylori vs noninfected cells (ratio of mRNA
e horizontal dotted lines represent the level of the noninfected
< n < 6. *P < .05, **P < .01, ***P < .001, and **** P < .0001 vs
t. #P< .05 vs noninfected siControls using Kruskal–Wallis test.
6. *and #P < .05, **P < .01 vs respective noninfected siControl
ontrol.
270 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2
A AGS MKN74 B AGASG S
# # # #
siCtrl siLATS2-1 siLATS2-2 siCtrl siLATS2-1 # # # #
1 0 0
* * * * * * * *
8 0
- * * * *
6 0
4 0
$ $ $ $
+ H. pylori 2 0
24 h 0
C tr li S 2 -1 S 2 -2 iC tr
l -1 -2
s L A T L A T s L A T
S 2 T S 2
s i s i s i s iL A
+ H . p y lo r i
C
AA G S MM K N 7 474 RPREP1E 1
# # # #
8 B M P 1 8 0 Z E B 1 1 2 B M P 1 * * * *
7 * * * * * * * * 1 0
6 Z E B 1 * * * 6 0 B M P 1 * * * * 8 M M P 95 4 0 6 * * * * * * * *
* * * * M M P 92 0 * *
4 * 55 # # * *4 * * * *
3 4
* * * * * * * ** * * * * * * * * 3 * *
2 * * * * 3 * * * * * * * *
2 * * * 2
1
1 1
0 0 0
iC tr
l
S 2 -1 2 -2 C tr
l
S i S 2 -1 S 2 -2 C tr
l
i S 2 -1
l
iC tr S 2 -1
l
iC tr S 2 -1 S 2 -2 iC tr
l -1 -2
s L A T L A T s
2 2
s i s i s iL A
T L A T s T s T s T T ss i s iL A s iL A s iL A s iL A s iL A
T S S
s iL A
T
H . p y lo r i
H . p y lo r i H . p y lo r i
D E
AGS RPE1 MKN74 AGS RPE1
ZEB1 (Green) Merge ZEB1 (Green) Merge ZEB1 (Green) Merge MMP9 (Green) Merge MMP9 (Green) Merge
F AGASG iSnIvn vaassiio n MKMNK N7744 iIn vvaas iosnion RPR PEE11 in vvaas isoinon
1 0 * * * * 4 5 * * * *
* *
8 4 * * * *
3
6 * * * * * * 3
* * *
2 * *
4 2
* * * * *
2 * * * * 1 1
0 0 0
tr l 2 -1 tr l l 1 2 ls iC
1 2
A T S s i
C
A T S
2 -1 F 2 tr - - tr - -
L L p
E G T S tr l -1 tr l -1 i C S 2 S 2 i C S 2 S 2
s i s i p
L A s iC L A T
S 2 s iC T S 2 s A T A T s A T A T
s i s iL A s i
L s i L s i L s i L
+ H . p y lo r i + H . p y lo r i + H . p y lo ri
+ H. pylori m R N A le v e l r e la t iv e t o
n o n - in fe c te d c o n tr o l c e lls
siLATS2-2 siLATS2-1 siCtrl siLATS2-2 siLATS2-1 siCtrl
F o ld c h a n g e r e la t iv e to
n o n - in fe c te d s iC o n tr o l c e lls
m R N A le v e l r e la t iv e t o
n o n - in fe c te d c o n tr o l c e lls
+ H. pylori
F o ld c h a n g e r e la t iv e to
n o n - in fe c t e d s iC o n tr o l c e lls siLATS2-1 siCtrl siLATS2-1 siCtrl
+ H. pylori
F o ld c h a n g e re la tiv e to siLATS2-2 siLATS2-1 siCtrl siLATS2-2 siLATS2-1 siCtrl
n o n -in fe c te d s iC o n tro l c e lls m R N A le v e l r e la t iv e t o
n o n - in fe c te d c o n tr o l c e lls P e rc e n ta g e o f c e lls w ith
H u m m in g b ird p h e n o ty p e
2020 LATS2 Controls H pylori–Induced Metaplasia 271supplemented with 10% heat-inactivated fetal calf serum
(all from Thermo Fisher Scientific, Courtaboeuf, France), at
37C in a 5% CO2 humidified atmosphere. The non-
tumorigenic, immortalized, human epithelial cell lines RPE1
(ATCC CRL-4000) and HMLE (kindly provided by R. Wein-
berg),25 of retinal and mammary origin, respectively, were
cultured in Dulbecco’s modified Eagle medium/F12-
Glutamax supplemented with 10% heat-inactivated fetal
calf serum supplemented with 10 mg/mL insulin, 0.10 ng/
mL epidermal growth factor, and 0.5 mg/mL hydrocortisone
(all from Sigma-Aldrich, St. Quentin Fallavier, France) ac-
cording to Mani et al25 for the HMLE cell line. The experi-
ments were performed with cells seeded at low density
(2.5  104 cells/well in 24-well plates). Phase-contrast
microscopy images of cell cultures were taken using an
inverted phase-contrast Zeiss microscope equipped with
a 20 objective and a Zeiss acquisition software (Munich,
Germany).
Bacterial Culture
H pylori strain 7.13 WT and its isogenic cagA-deleted
mutant were cultured on Columbia agar plates at 37C un-
der microaerophilic (5% O2) conditions, as previously
described.8,9 The coculture experiments were performed at
a multiplicity of infection of 50.
Infection Experiments in Mice
Five-week-old C57BL/6J female mice were inoculated by
oral gavage of the cagPAI and cagA-positive H pylori strain
HPARE suspension every other day for 3 days, and 3–12
months later their stomach tissues were fixed and pro-
cessed for standard histology as previously described.9,19
RNA Extraction, Transcriptome, and RT-qPCR
Cell RNAs were extracted using TRIzol reagent (Thermo
Fisher Scientific) as recommended and quantified by their
absorbance at 260 nm. For the transcriptome, RNAs were
extracted using RNeasy (Qiagen, Courtaboeuf, France),
and the RNA integrity number (RIN) were determined on
the TapeStation (Agilent, Les Ulis, France). The tran-
scriptome was performed with the GeTRix PlatformFigure 6. (See previous page). LATS2 restricts H pylori–indu
siCtrl- and siLATS2-transfected cells upon 24 hours of HPI with
AGS cells (left panel), Yellow arrows indicate cells with the elong
at 24 hours of HPI. (b) In MKN74 cells (right panel), Yellow arro
siLATS2 cells infected or not infected. (B) Percentage of cells w
respective noninfected condition. ****P < .0001 vs the respectiv
controls. $$$$ P < .0001 vs noninfected control cells in analysis
(dark grey bars), BMP1 (light grey bars), MMP9 (crosshatched ba
in siControl-, siLATS2-1–, and siLATS2-2–transfected AGS, MK
SEM of RT-qPCR data, 3 < n < 6. *P < .05, **P < .01, ***P
Kruskal–Wallis test. ##P < .01 vs H pylori–infected siControl u
cellular localization of (D) ZEB1 and (E) MMP9 (in green) assesse
actin was marked with Alexa-546–labeled phalloidin (red) and nu
(F) Invasion capacity through collagen 1–coated Transwell in
siLATS2-transfected AGS, MKN74, and RPE1 cells, and of noni
at 24 hours of HPI. Bars represent the mean fold changes ± SEM
hours after plating, compared with noninfected siControl cells
siControl using the Kruskal–Wallis test. siCtrl, siControl.(Toulouse, France), and the Agilent G3 HGE 8  60 micro-
arrays (Thermo Fisher Scientific). For RT-qPCR, the RT was
performed with 1 mg total RNA using the Quantitect Reverse
Transcription kit (Qiagen) as recommended. Quantitative
PCR was performed using the SYBR-qPCR-Master mix
(Promega, Lyon, France), with 0.3 mmol/L specific primers
(LATS2 forward primer sequence CAGGATGCGACCAGGA-
GATG and reverse primer sequence CCGCA-
CAATCTGCTCATTC; YAP1 forward: CACAGCATGTTC
GAGCTCAT, reverse: GATGCTGAGCTGTGGGTGTA; CTGF
forward: GCCACAAGCTGTCCAGTCTAATCG, reverse:
TGCATTCTCCAGCCATCAAGAGAC; CYR61 forward:
ATGAATTGATTGCAGTTGGAAA, reverse: TAAAGGGTTGTA-
TAGGATGCGA; ZEB1 forward: TCCCAACTTATGCCAGGCAC,
reverse: CAGGAACCACATTTGTCATAGTCAC; Hypoxanthine
Phosphoribosyltransferase 1 (HPRT1) forward: TGGTCA
GGCAGTATAATCCA, reverse: GGTCCTTTTCACCAGCAAGCT;
Tata-binding protein (TBP) forward: GGGCATTATTTGTG-
CACTGAGA, reverse: GCCCAGATAGCAGCACGGT; CDX2 for-
ward: GACGTGAGCATGTACCCTAGC, reverse: GCGTA
GCCATTCCAGTCCT; SOX9 forward: CGGAGGAAGTCGGT-
GAAG, reverse: CTGGGATTGCCCCGAGTGCT; and MUC2 for-
ward: ACAACTACTCCTCTACCTCCA, reverse:
GTTGATCTCGTAGTTGAGGCA; BMP1 Quantitect primer
assay, cat. QT00000819; KRT7 Quantitect primer assay, cat.
QT01672951; MMP9 Quantitect primer assay, cat.
QT00040040; and MUC5AC Quantitect primer assay, cat.
QT00088991) and 1:200 of the RT reaction volume. The
amplification steps were as follows: 94C for 15 seconds,
60C for 30 seconds, and 72C for 30 seconds, for 45 cycles.
Relative expression was calculated using the comparative
cycle treshold (Ct) method, with both HPRT1 and TBP as
normalizers.Transfection and Luciferase Reporter Assays
Cells were grown in 24-well plates and transfection of
plasmids and siRNAs were performed using Lipofectamine
2000 and Lipofectamine RNAiMAX, respectively (Thermo
Fisher Scientific) as recommended. Nonsilencing control
siRNA (Allstars negative, cat. SI03650318; Qiagen) with no
known homology to mammalian genes was used as a
negative control. siRNA directed against human LATS2ced EMT in AGS cells. (A) Phase-contrast images of cells in
H pylori 7.13 WT in AGS and MKN74. Scale bars: 20 mm. (a) In
ated hummingbird phenotype appearing in siLATS2 cells and
ws indicate loosely attached round cell clusters appearing in
ith the hummingbird phenotype in AGS cells. *P < .05 vs the
e noninfected condition. #### P < .0001 vs H. pylori–infected
of variance test. (C) Relative levels for the EMT markers ZEB1
rs) mRNAs, measured at 24 hours of HPI with H pylori 7.13 WT
N74, and RPE1 cells. Bars represent the mean fold changes ±
< .001, ****P < .0001 vs noninfected siControl using the
sing the Kruskal–Wallis test. (D and E) Expression and sub-
d by immunofluorescence in AGS, RPE1, and MKN74 cells. F-
clei with 4’-6-diamino-phenyl-indol (blue). Scale bars: 10 mm.
serts of H pylori–infected and noninfected siControl- and
nfected pEGFP- (control) and pLATS2-transfected AGS cells,
(n ¼ 5) of the number of cells having crossed the Transwell 18
. **P < .01, ***P < .001, and ****P < .0001 vs noninfected
272 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2(LATS2-1, cat. GS26524; Qiagen; and LATS2-2, cat. SO-
2702484G/M-003865-02-0005, Dharmacon, Denver, CO)
and YAP1 (YAP1-1, cat. GS10413; Qiagen; and YAP1-2,
sequence 5’-UGUGGAUGAGAUGGAUAGA-3’, Eurofins, Dort-
mund, Germany) were used at 20 nmol/L; 2 rounds ofA AGS
CDX2 (Green) Merge Muc2 (Green) Me
D
AAGG S C D X 2
K R T 7
1 5 * * * * M U C 2
1 0 * * *
5 * * * * * * * * ** *
2 .0 *
* *
1 .5
1 .0
0 .5
0 .0
t r l 2 -1 2 -2C t
r l 2 -1 2 -2
s i T SA A T
S s iC T S SA A T
s i L s i L s i L s i L
H .  p y lo r i
+ H. pylori
m R N A  le v e l r e la t iv e  t o
n o n - in fe c te d  c o n t r o l c e lls siLATS2-2 siLATS2-1 siCtrl siLATS2-2 siLATS2-1 siCtrl
siRNA transfection were performed. The TEAD (8  GTII-
luciferase was a gift from Stefano Piccolo25) or TATA box
control (transcription-activator like [TAL], BectonDickinson,
Le Pont de Claix, France) firefly luciferase reporters were
transfected at 100 ng/well, in the presence of 10 ng/wellB AGS
rge - + H. pylori
C
A G S
C D X 2
1 0 0 IA P* * * * * * *
5 0 *
* *
*
0
C t r
l 1 r l 1
s i 2
- t -
A T
S s iC T S
2
s i L s i L
A
+ H . p y lo r i
E
MMKKNN 7 4
C D X 2
3 S O X 9
* * * M U C 5 A C
* * *
2 * *
1 # #
* * * * * * * *
0
tr l -1 t r l -1
s iC T S
2
A s
iC 2
A T
S
s iL s iL
H . p y lo r i
m R N A  le v e l r e la t iv e  t o
n o n - in fe c te d  c o n tr o l c e lls
P e r c e n t a g e  o f  p o s i t i v e  c e l l s
siLATS2-1 siCtrl
2020 LATS2 Controls H pylori–Induced Metaplasia 273Renilla luciferase reporter (pRL-SV40; Promega). Firefly and
Renilla luciferase activities were measured using the Dual
Luciferase Assay (Promega). Firefly luciferase activities
were normalized for transfection efficiency by Renilla
luciferase for each sample, and TEAD-specific luciferase
activity then was normalized to that of TAL. The expression
vectors plasmid cloning desoxyribonucleic acid (pcDNA)-
Flag-YAP1, plasmid with Cytomegalovirus promoter
(pCMV)-flagS127A-YAP1, and pCMVmyc-LATS2 vectors
were generous gifts from Yosef Shaul,40 Kunliang Guan,41
and Professor H Nojima, Osaka, Japan,7 respectively); the
control pEGFP-C3 vector was from Promega. The expression
vectors were transfected at 500 ng/well.
Western Blot
Cells were lysed on ice in ProteoJET reagent (Thermo
Fisher Scientific) supplemented with a protease/phospha-
tase inhibitor cocktail (Sigma-Aldrich). The extracted pro-
teins were submitted to sodium dodecyl
sulfate–polyacrylamide gel electrophoresis and Western
blot on Protean nitrocellulose membranes (Amersham,
Orsay, France) for immunolabeling. Immunolabeling was
performed using rabbit anti-YAP1, anti–YAP1-PSer127, and
anti–LATS1/2-PThr1079/1041 (each at 1:2000, cat. 4912, cat.
4911, and cat. 8654, respectively; Cell Signaling Technology,
Ozyme, St. Quentin-en-Yvelines, France), rabbit anti-LATS1/
2 (1:2000, cat. A300-479; Bethyl, Souffelweyersheim,
France), mouse anti–a-tubulin (1:8000; cat. T-6074, Sigma-
Aldrich), mouse anti–glyceraldehyde-3-phosphate dehydro-
genase (1:2000, sc-47724; Santa Cruz Biotechnology,
Heidelberg, Germany), followed by horseradish-perox-
idase–coupled, anti-rabbit and anti-mouse secondary anti-
bodies (DAKO, Les Ulis, France) and chemoluminescent
detection (ECLþ, Amersham). The band intensities relative
to a-tubulin or glyceraldehyde-3-phosphate dehydrogenase
were quantified using ImageJ software (National Institutes
of Health, Bethesda, MD).
Immunocytofluorescence
Cells (2.5  104) cultured on glass coverslips were fixed
in a 4% paraformaldehyde solution in phosphate-buffered
saline supplemented with 1 mmol/L CaCl2 and 1 mmol/L
MgCl2 (Ca-Mg) for 10 minutes and permeabilized in 0.1%
Triton X-100 (Sigma-Aldrich, Lyon, France) in Tris-Buffered
Saline (TBS)-Ca-Mg for 1 minute at room temperature. After
blocking with 1% bovine serum albumin, 2% fetal calf
serum solution in TBS-Ca-Mg, they were incubated stepwise
with either a rabbit anti-LATS1/2 (1:200 dilution, Bethyl),Figure 7. (See previous page). LATS2 controls H pylori–elicit
CDX2 and MUC2, assessed by immunofluorescent staining (in g
phalloidin (in red) and nuclei with 4’-6-diamino-phenyl-indol (in
BCIP/NBT transformation (cytoplasmic dark blue foci) and coun
HPI. Scale bars: 10 mm. Black arrows indicate IAP activity dete
percentage of positive cells for CDX2 (white dotted bars) and IA
the mean fold changes ± SD, n ¼ 3. *P < .05, **P < .01, ***P <
analysis of variance. (D and E) Relative expression of CDX2, K
mean fold changes ± SEM of RT-qPCR data, n ¼ 3. *P < .05, **P
cells using the Kruskal–Wallis test. ##P < .01 vs H pylori–infectanti-YAP1 (1:100, Cell Signaling), anti–YAP1-PSer127 (1:200,
Cell Signaling), anti-ZEB1 (1:100, cat. A301-922, Bethyl),
anti-Mucin 2 (1:50, cat. sc-15334, Santa Cruz Biotech-
nology), a mouse anti-CDX2 (prediluted ready to use, CDX2-
88 ab86949; Abcam, Paris, France), anti-MMP9 (1:100, H-
300, sc-21733, Santa Cruz Technology) antibody for 1 hour
at room temperature, followed by a goat anti-rabbit Alexa-
488–labeled secondary antibody (1:250, cat. A32731;
Thermo Fisher Scientific) or a donkey anti-mouse Alexa-
488–labeled secondary antibody (1:250, cat A21202,
Thermo Fisher Scientific) mixed to Alexa-546–labeled
phalloidin (1:250, cat. A22283, Thermo Fisher Scientific)
and 4’-6-diamino-phenyl-indol (50 mg/mL, cat. D9542;
Sigma-Aldrich) for 1 hour at room temperature. The cov-
erslips were mounted on glass slides using Slowfade reagent
(S36936; Thermo Fisher Scientific). Images were taken us-
ing an Eclipse 50i epi-fluorescence microscope (Nikon,
Champigny sur Marne, France) with Nis Element acquisition
software and a 40 (numeric aperture, 1.3) oil immersion
objective.Cytology and Immunocytology
Cells were cultured and processed as for
immunostaining. Alkaline phosphatase activity was detected
by the 5-bromo-4-chloro-3-indolyl-phosphate/nitroblue
tetrazolium (BCIP/NBT) Alkaline Phosphatase Substrate Kit
IV, following the manufacturer’s instructions (Vector Labo-
ratories, Interchim, Montluçon, France) and slides were
counterstained with nuclear fast red, dehydrated, and
mounted on slides with Eukitt-mounting medium (VWR,
Fontenay-sous-Bois, France).19Invasion Assay
Cells were recovered by trypsinization and 2.5  104
cells per condition were placed in the upper side of a 8-
mm pore size Corning Transwell (Sigma-Aldrich) insert,
previously coated with rat-tail type 1 collagen (Becton
Dickinson), in 24-well culture plates with medium con-
taining 5% fetal bovine serum. After 18 hours of incubation
at 37C, the Transwell inserts were fixed in 4%
paraformaldehyde solution and labeled with 4’-6-diamino-
phenyl-indol. Cells from the upper part of the Transwell
inserts were removed by swabbing and cells that invaded
through the lower side of the inserts were counted on 5
different randomly chosen fields per insert under micro-
scopy with the ZOE fluorescent Cell Imager (BioRad,
Marnes-la-Coquette, France).ed metaplasia. (A) Expression and subcellular localization of
reen) in AGS cells. F-actin was stained with Alexa-546–labeled
blue). Scale bars: 10 mm. (B) The IAP activity, assessed by
tercoloration by nuclear fast red, in AGS cells at 24 hours of
cted as dark blue foci in AGS cells. (C) Quantification of the
P (grid bars) by light microscopy observation. Bars represent
.001, and ****P < .0001 vs noninfected siControl cells using
RT7, MUC2, SOX9, and MUC5AC mRNA; bars represent the
< .01, ***P < .001, and ****P < .0001 vs noninfected siControl
ed siControl using the Kruskal–Wallis test.
274 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2Immunohistochemistry
Tissue sections (3-mm thick) were prepared from
formalin-fixed, paraffin-embedded human tissues and un-
derwent standard immunohistochemistry protocols for
LATS2 (rabbit anti-LATS1/2, 1:100, 2 h; Bethyl), YAP1
(rabbit anti-YAP1, 1:100, 1 h; Cell Signaling), or H pylori
(rabbit anti–H pylori 1:100, 2 h, cat. B0471; DAKO) anti-
bodies, and then with horseradish-peroxidase–labeled anti-
rabbit EnVision System (30 min; DAKO).17 Immunolabeling
was shown after a 10-minute incubation in liquid
diaminobenzidine-chromogen substrate (cat. K3468;
DAKO). Slides were counterstained with hematoxylin,
dehydrated, and mounted with Eukitt-mounting medium
(VWR). Relative quantification of the percentage of gastric
epithelial cells expressing nuclear LATS2 and nuclear YAP1
was determined by a double-blind scoring using a scale
from 1 to 4 (0, 0%; 1, <5%; 2, 5%–25%; 3, 25%–50%; and
4, >50%).Statistical Analysis
Quantification values represent the means of 3 or more
independent experiments, each performed by triplicate or
more ± SEM. The Mann–Whitney test was used to compare
between 2 groups and the Kruskal–Wallis test with the
Dunn posttest or analysis of variance tests and Bonferroni
post hoc test were used for multiple comparisons. Statistics
were performed on GraphPad Prism 7.02 software (San
Diego, CA, USA).References
1. Correa P, Houghton J. Carcinogenesis of Helicobacter
pylori. Gastroenterology 2007;133:659–672.
2. Bray F, Jemal A, Grey N, Ferlay J, Forman D. Global
cancer transitions according to the Human Development
Index (2008-2030): a population-based study. Lancet
Oncol 2012;13:790–801.
3. Backert S, Selbach M. Role of type IV secretion in Heli-
cobacter pylori pathogenesis. Cell Microbiol 2008;
10:1573–1581.
4. Megraud F, Bessede E, Varon C. Helicobacter pylori
infection and gastric carcinoma. Clin Microbiol Infect
2015;21:984–990.
5. Mimuro H, Suzuki T, Nagai S, Rieder G, Suzuki M,
Nagai T, Fujita Y, Nagamatsu K, Ishijima N, Koyasu S,
Haas R, Sasakawa C. Helicobacter pylori dampens gut
epithelial self-renewal by inhibiting apoptosis, a bacterial
strategy to enhance colonization of the stomach. Cell
Host Microbe 2007;2:250–263.
6. Hatakeyama M. Helicobacter pylori and gastric carcino-
genesis. J Gastroenterol 2009;44:239–248.
7. Belair C, Baud J, Chabas S, Sharma CM, Vogel J,
Staedel C, Darfeuille F. Helicobacter pylori interferes with
an embryonic stem cell micro RNA cluster to block cell
cycle progression. Silence 2010;2:7.
8. Baud J, Varon C, Chabas S, Chambonnier L, Darfeuille F,
Staedel C. Helicobacter pylori initiates a mesenchymal
transition through ZEB1 in gastric epithelial cells. PLoS
One 2013;8:e60315.9. Bessede E, Staedel C, Acuna Amador LA, Nguyen PH,
Chambonnier L, HatakeyamaM,BelleanneeG,MegraudF,
Varon C. Helicobacter pylori generates cells with cancer
stem cell properties via epithelial-mesenchymal transition-
like changes. Oncogene 2014;33:4123–4131.
10. Thiery JP, Acloque H, Huang RY, Nieto MA. Epithelial-
mesenchymal transitions in development and disease.
Cell 2009;139:871–890.
11. Yu FX, Zhao B, Guan KL. Hippo pathway in organ size
control, tissue homeostasis, and cancer. Cell 2015;
163:811–828.
12. Piccolo S, Dupont S, Cordenonsi M. The biology of YAP/
TAZ: hippo signaling and beyond. Physiol Rev 2014;
94:1287–1312.
13. Hansen CG, Moroishi T, Guan KL. YAP and TAZ: a nexus
for Hippo signaling and beyond. Trends Cell Biol 2015;
25:499–513.
14. Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the
roots of cancer. Cancer Cell 2016;29:783–803.
15. KangW, Tong JH, Chan AW, Lee TL, Lung RW, Leung PP,
SoKK,WuK, FanD, Yu J, Sung JJ, ToKF. Yes-associated
protein 1 exhibits oncogenic property in gastric cancer
and its nuclear accumulation associates with poor prog-
nosis. Clin Cancer Res 2011;17:2130–2139.
16. Song M, Cheong JH, Kim H, Noh SH, Kim H. Nuclear
expression of Yes-associated protein 1 correlates with
poor prognosis in intestinal type gastric cancer. Anti-
cancer Res 2012;32:3827–3834.
17. Yu L, Gao C, Feng B, Wang L, Tian X, Wang H, Ma D.
Distinct prognostic values of YAP1 in gastric cancer.
Tumour Biol 2017;39:1010428317695926.
18. Bessede E, Dubus P, Megraud F, Varon C. Helicobacter
pylori infection and stem cells at the origin of gastric
cancer. Oncogene 2015;34:2547–2555.
19. Varon C, Dubus P, Mazurier F, Asencio C,
Chambonnier L, Ferrand J, Giese A, Senant-Dugot N,
Carlotti M, Megraud F. Helicobacter pylori infection re-
cruits bone marrow-derived cells that participate in
gastric preneoplasia in mice. Gastroenterology 2012;
142:281–291.
20. Bessede E, Molina S, Amador LA, Dubus P, Staedel C,
Chambonnier L, Buissonniere A, Sifre E, Giese A,
Benejat L, Rousseau B, Costet P, Sacks DB, Megraud F,
Varon C. Deletion of IQGAP1 promotes Helicobacter
pylori-induced gastric dysplasia in mice and acquisition
of cancer stem cell properties in vitro. Oncotarget 2016;
7:80688–80699.
21. Jiao S, Li C, Hao Q, Miao H, Zhang L, Li L, Zhou Z.
VGLL4 targets a TCF4-TEAD4 complex to coregulate
Wnt and Hippo signalling in colorectal cancer. Nat
Commun 2017;8:14058.
22. Szymaniak AD, Mahoney JE, Cardoso WV, Varelas X.
Crumbs3-mediated polarity directs airway epithelial cell
fate through the Hippo pathway effector Yap. Dev Cell
2015;34:283–296.
23. Tanaka I, Osada H, Fujii M, Fukatsu A, Hida T, Horio Y,
Kondo Y, Sato A, Hasegawa Y, Tsujimura T, Sekido Y.
LIM-domain protein AJUBA suppresses malignant me-
sothelioma cell proliferation via Hippo signaling cascade.
Oncogene 2015;34:73–83.
2020 LATS2 Controls H pylori–Induced Metaplasia 27524. Philippe C, Pinson B, Dompierre J, Pantesco V, Viollet B,
Daignan-Fornier B, Moenner M. AICAR antiproliferative
properties involve the AMPK-independent activation of
the tumor suppressors LATS 1 and 2. Neoplasia 2018;
20:555–562.
25. Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A,
Zhou AY, Brooks M, Reinhard F, Zhang CC, Shipitsin M,
Campbell LL, Polyak K, Brisken C, Yang J, Weinberg RA.
The epithelial-mesenchymal transition generates cells
with properties of stem cells. Cell 2008;133:704–715.
26. von Eyss B, Jaenicke LA, Kortlever RM, Royla N,
Wiese KE, Letschert S, McDuffus LA, Sauer M,
Rosenwald A, Evan GI, Kempa S, Eilers M. A MYC-driven
change in mitochondrial dynamics limits YAP/TAZ
function in mammary epithelial cells and breast cancer.
Cancer Cell 2015;28:743–757.
27. Barros R, Freund JN, David L, Almeida R. Gastric intes-
tinal metaplasia revisited: function and regulation of
CDX2. Trends Mol Med 2012;18:555–563.
28. Yamamoto H, Bai YQ, Yuasa Y. Homeodomain protein
CDX2 regulates goblet-specific MUC2 gene expression.
Biochem Biophys Res Commun 2003;300:813–818.
29. Goldberg RF, Austen WG Jr, Zhang X, Munene G,
Mostafa G, Biswas S, McCormack M, Eberlin KR,
Nguyen JT, Tatlidede HS, Warren HS, Narisawa S,
Millan JL, Hodin RA. Intestinal alkaline phosphatase is a
gut mucosal defense factor maintained by enteral nutri-
tion. Proc Natl Acad Sci U S A 2008;105:3551–3556.
30. Zhang X, Shi D, Liu YP, Chen WJ, Wu D. Effects of the
Helicobacter pylori virulence factor CagA and ammo-
nium ion on mucins in AGS cells. Yonsei Med J 2018;
59:633–642.
31. Serizawa T, Hirata Y, Hayakawa Y, Suzuki N,
Sakitani K, Hikiba Y, Ihara S, Kinoshita H, Nakagawa H,
Tateishi K, Koike K. Gastric metaplasia induced by
Helicobacter pylori is associated with enhanced SOX9
expression via interleukin-1 signaling. Infect Immun
2016;84:562–572.
32. Yi J, Lu L, Yanger K, Wang W, Sohn BH, Stanger BZ,
Zhang M, Martin JF, Ajani JA, Chen J, Lee JS, Song S,
Johnson RL. Large tumor suppressor homologs 1 and 2
regulate mouse liver progenitor cell proliferation and
maturation through antagonism of the coactivators YAP
and TAZ. Hepatology 2016;64:1757–1772.
33. Park GS, Oh H, Kim M, Kim T, Johnson RL, Irvine KD,
Lim DS. An evolutionarily conserved negative feedback
mechanism in the Hippo pathway reflects functional
difference between LATS1 and LATS2. Oncotarget 2016;
7:24063–24075.
34. Barry ER, Camargo FD. The Hippo superhighway:
signaling crossroads converging on the Hippo/Yap
pathway in stem cells and development. Curr Opin Cell
Biol 2013;25:247–253.
35. Ramos A, Camargo FD. The Hippo signaling pathway
and stem cell biology. Trends Cell Biol 2012;22:339–346.
36. Furth N, Aylon Y. The LATS1 and LATS2 tumor sup-
pressors: beyond the Hippo pathway. Cell Death Differ
2017;24:1488–1501.
37. Moroishi T, Park HW, Qin B, Chen Q, Meng Z,
Plouffe SW, Taniguchi K, Yu FX, Karin M, Pan D,Guan KL. A YAP/TAZ-induced feedback mechanism
regulates Hippo pathway homeostasis. Genes Dev 2015;
29:1271–1284.
38. Kulkarni M, Tan TZ, Syed Sulaiman NB, Lamar JM,
Bansal P, Cui J, Qiao Y, Ito Y. RUNX1 and RUNX3 pro-
tect against YAP-mediated EMT, stem-ness and shorter
survival outcomes in breast cancer. Oncotarget 2018;
9:14175–14192.
39. Qiao Y, Lin SJ, Chen Y, Voon DC, Zhu F, Chuang LS,
Wang T, Tan P, Lee SC, YeohKG, SudolM, Ito Y. RUNX3 is
a novel negative regulator of oncogenic TEAD-YAP com-
plex in gastric cancer. Oncogene 2016;35:2664–2674.
40. Levy D, Adamovich Y, Reuven N, Shaul Y. The Yes-
associated protein 1 stabilizes p73 by preventing Itch-
mediated ubiquitination of p73. Cell Death Differ 2007;
14:743–751.
41. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, Xie J,
Ikenoue T, Yu J, Li L, Zheng P, Ye K, Chinnaiyan A,
Halder G, Lai ZC, Guan KL. Inactivation of YAP onco-
protein by the Hippo pathway is involved in cell contact
inhibition and tissue growth control. Genes Dev 2007;
21:2747–2761.
42. Li W, Cooper J, Zhou L, Yang C, Erdjument-
Bromage H, Zagzag D, Snuderl M, Ladanyi M,
Hanemann CO, Zhou P, Karajannis MA, Giancotti FG.
Merlin/NF2 loss-driven tumorigenesis linked to
CRL4(DCAF1)-mediated inhibition of the hippo
pathway kinases Lats1 and 2 in the nucleus. Cancer
Cell 2014;26:48–60.
43. Enderle L, McNeill H. Hippo gains weight: added insights
and complexity to pathway control. Sci Signal 2013;6:re7.
44. Murata-Kamiya N, Kurashima Y, Teishikata Y,
Yamahashi Y, Saito Y, Higashi H, Aburatani H,
Akiyama T, Peek RM Jr, Azuma T, Hatakeyama M. Hel-
icobacter pylori CagA interacts with E-cadherin and de-
regulates the beta-catenin signal that promotes intestinal
transdifferentiation in gastric epithelial cells. Oncogene
2007;26:4617–4626.
45. Amieva MR, Vogelmann R, Covacci A, Tompkins LS,
Nelson WJ, Falkow S. Disruption of the epithelial apical-
junctional complex by Helicobacter pylori CagA. Science
2003;300:1430–1434.
46. Hatakeyama M. Helicobacter pylori CagA and gastric
cancer: a paradigm for hit-and-run carcinogenesis. Cell
Host Microbe 2014;15:306–316.
47. Coulombe G, Rivard N. New and unexpected biological
functions for the Src-homology 2 domain-containing
phosphatase SHP-2 in the gastrointestinal tract. Cell
Mol Gastroenterol Hepatol 2011;2:11–21.
48. Tsutsumi R, Masoudi M, Takahashi A, Fujii Y, Hayashi T,
Kikuchi I, Satou Y, Taira M, Hatakeyama M. YAP and
TAZ, Hippo signaling targets, act as a rheostat for nu-
clear SHP2 function. Dev Cell 2013;26:658–665.
49. Yamazaki S, Yamakawa A, Ito Y, Ohtani M, Higashi H,
Hatakeyama M, Azuma T. The CagA protein of Heli-
cobacter pylori is translocated into epithelial cells and
binds to SHP-2 in human gastric mucosa. J Infect Dis
2003;187:334–337.
50. Lehmann W, Mossmann D, Kleemann J, Mock K,
Meisinger C, Brummer T, Herr R, Brabletz S,
276 Molina-Castro et al Cellular and Molecular Gastroenterology and Hepatology Vol. 9, No. 2Stemmler MP, Brabletz T. ZEB1 turns into a transcrip-
tional activator by interacting with YAP1 in aggressive
cancer types. Nat Commun 2016;7:10498.
51. Yao F, Liu H, Li Z, Zhong C, Fang W. Down-regulation of
LATS2 in non-small cell lung cancer promoted the
growth and motility of cancer cells. Tumour Biol 2015;
36:2049–2057.
52. Furth N, Bossel Ben-Moshe N, Pozniak Y, Porat Z,
Geiger T, Domany E, Aylon Y, Oren M. Down-regulation
of LATS kinases alters p53 to promote cell migration.
Genes Dev 2015;29:2325–2330.
53. Cobler L, Pera M, Garrido M, Iglesias M, de Bolos C.
CDX2 can be regulated through the signalling pathways
activated by IL-6 in gastric cells. Biochim Biophys Acta
2014;1839:785–792.
54. Camilo V, Barros R, Sousa S, Magalhaes AM, Lopes T,
Mario Santos A, Pereira T, Figueiredo C, David L,
Almeida R. Helicobacter pylori and the BMP pathway
regulate CDX2 and SOX2 expression in gastric cells.
Carcinogenesis 2012;33:1985–1992.
55. Naumann M, Sokolova O, Tegtmeyer N, Backert S. Heli-
cobacter pylori: a paradigm pathogen for subverting host
cell signal transmission. Trends Microbiol 2017;
25:316–328.
Received April 19, 2018. Accepted October 18, 2019.
Correspondence
Address correspondence to: Christine Varon, PhD, INSERM U1053
Bordeaux Research in Translational Oncology (BaRITOn), University of
Bordeaux, 146 Rue Léo Saignat, 33076 Bordeaux Cedex, France. e-mail:christine.varon@u-bordeaux.fr; fax: þ33 5 56 79 60 18; or Cathy Staedel,
PhD, INSERM U1212, “ARN: Régulations naturelle et artificielle” (ARNA)-
Unités Mixtes de Recherche (UMR) Centre national de la recherche
scientifique (CNRS) 5320, University of Bordeaux, 146 Rue Léo Saignat,
33076 Bordeaux Cedex, France. e-mail: cathy.staedel@inserm.fr; fax: þ33 5
57 57 10 15.
Acknowledgments
The authors thank Dr Richard Peek (Vanderbilt University, Nashville, TN) for the
H pylori strains 7.13 and isogenic cagA-deleted mutant, Professor Nojima
(Osaka, Japan) for the pCMVmyc-LATS2 plasmid, Yannick Lippi (GeTRix
Platform, Toulouse, France) for statistical analyses of the transcriptome, and
Michel Moenner (CNRS UMR5095, University of Bordeaux, Bordeaux,
France) for providing P-LATS2 antibodies and for helpful discussions. The
authors thank Solène Fernandez for technical assistance and Julie
Pannequin (IGF, University of Montpellier, Montpellier, France), and Jacques
Robert (INSERM U1218, University of Bordeaux, France) for their helpful
scientific advice and discussions.
Author contributions
Silvia Elena Molina Castro acquired, analyzed, and interpreted the data,
performed the statistical analysis, and drafted the manuscript; Julie Giraud
and Camille Tiffon acquired, analyzed, and interpreted the data, and
performed the statistical analysis; Elodie Sifre and Alban Giese provided
technical support; Geneviève Belleannée and Hélène Boeuf provided material
support; Hélène Boeuf, Emilie Bessède, Philippe Lehours, Francis Mégraud,
and Pierre Dubus critically revised the manuscript for important intellectual
content; Cathy Staedel was responsible for the study concept, acquired,
analyzed, and interpreted the data, and drafted the manuscript; and Christine
Varon was responsible for the study concept, analyzed and interpreted the
data, designed and supervised the study, drafted the manuscript, and
obtained funding.
Conflicts of interest
The authors disclose no conflicts.
Funding
Supported by the French National Institute for Cancer (PLBio 2014-152 to J.G.
and C.T.), and the French Association Ligue Nationale Contre le Cancer (C.T.).
Silvia Elena Molina Castro is a PhD fellowship recipient of the University of
Costa Rica (San José, Costa Rica) and the Ministry of Science, Technology
and Communications (Costa Rica).